bamhi into ptyb21 (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
bamhi into ptyb21
Bamhi Into Ptyb21, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 13691 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bamhi+into+ptyb21/BamHI/pmc05587573-268-30-33
Average 99 stars, based on 13691 article reviews
Bamhi Into Ptyb21, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 13691 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bamhi+into+ptyb21/BamHI/pmc05587573-268-30-33
Average 99 stars, based on 13691 article reviews
bamhi into ptyb21 - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Amplification:Article Title: Structural and molecular comparison of bacterial and eukaryotic trigger factors Article Snippet: .. Mature A . thaliana TIG1 (lacking the putative N-terminal 27 amino-acid transit peptide), was amplified by PCR from cDNA with the primers (5′-GGGGCATATGTCCCGTCTCTTCCAATCAG-3′) and (5′-CCCCGGATCCTCAACGAGTGATGTATTGAATC-3′) and cloned with NdeI and Article Title: Structural and molecular comparison of bacterial and eukaryotic trigger factors Article Snippet: For correction of the mature protein, 49 amino acids were removed from the N-terminal sequence with oligos 5′-GGAAGAGCTCATATGTCCCGTCTCTTCCAATCAGATAGTGT GCTACAGTTTGGTGGGAGGTTGAAGAAACCAATTAGCAGGCCTTTGGACATGTCTTGTGTCTCTAGAAAAATTGGATTTTTCGGA GATTTTATGTCACATGGTGGTAATTTTAGGCTATTC-3′ by site directed mutagenesis resulting in pFW136. .. The TF sequence from E . coli was amplified by PCR from DH5alpha genomic DNA with primers (5′-GGGGCATATGCAAGTTTCAGTTGAAACCAC-3′) and (5′-CCCCGGATCCTTACGCCTGCTGGTTCATC-3′) and cloned with NdeI and Polymerase Chain Reaction:Article Title: Structural and molecular comparison of bacterial and eukaryotic trigger factors Article Snippet: .. Mature A . thaliana TIG1 (lacking the putative N-terminal 27 amino-acid transit peptide), was amplified by PCR from cDNA with the primers (5′-GGGGCATATGTCCCGTCTCTTCCAATCAG-3′) and (5′-CCCCGGATCCTCAACGAGTGATGTATTGAATC-3′) and cloned with NdeI and Article Title: Structural and molecular comparison of bacterial and eukaryotic trigger factors Article Snippet: For correction of the mature protein, 49 amino acids were removed from the N-terminal sequence with oligos 5′-GGAAGAGCTCATATGTCCCGTCTCTTCCAATCAGATAGTGT GCTACAGTTTGGTGGGAGGTTGAAGAAACCAATTAGCAGGCCTTTGGACATGTCTTGTGTCTCTAGAAAAATTGGATTTTTCGGA GATTTTATGTCACATGGTGGTAATTTTAGGCTATTC-3′ by site directed mutagenesis resulting in pFW136. .. The TF sequence from E . coli was amplified by PCR from DH5alpha genomic DNA with primers (5′-GGGGCATATGCAAGTTTCAGTTGAAACCAC-3′) and (5′-CCCCGGATCCTTACGCCTGCTGGTTCATC-3′) and cloned with NdeI and Clone Assay:Article Title: Structural and molecular comparison of bacterial and eukaryotic trigger factors Article Snippet: .. Mature A . thaliana TIG1 (lacking the putative N-terminal 27 amino-acid transit peptide), was amplified by PCR from cDNA with the primers (5′-GGGGCATATGTCCCGTCTCTTCCAATCAG-3′) and (5′-CCCCGGATCCTCAACGAGTGATGTATTGAATC-3′) and cloned with NdeI and Article Title: Structural and molecular comparison of bacterial and eukaryotic trigger factors Article Snippet: For correction of the mature protein, 49 amino acids were removed from the N-terminal sequence with oligos 5′-GGAAGAGCTCATATGTCCCGTCTCTTCCAATCAGATAGTGT GCTACAGTTTGGTGGGAGGTTGAAGAAACCAATTAGCAGGCCTTTGGACATGTCTTGTGTCTCTAGAAAAATTGGATTTTTCGGA GATTTTATGTCACATGGTGGTAATTTTAGGCTATTC-3′ by site directed mutagenesis resulting in pFW136. .. The TF sequence from E . coli was amplified by PCR from DH5alpha genomic DNA with primers (5′-GGGGCATATGCAAGTTTCAGTTGAAACCAC-3′) and (5′-CCCCGGATCCTTACGCCTGCTGGTTCATC-3′) and cloned with NdeI and Sequencing:Article Title: Structural and molecular comparison of bacterial and eukaryotic trigger factors Article Snippet: For correction of the mature protein, 49 amino acids were removed from the N-terminal sequence with oligos 5′-GGAAGAGCTCATATGTCCCGTCTCTTCCAATCAGATAGTGT GCTACAGTTTGGTGGGAGGTTGAAGAAACCAATTAGCAGGCCTTTGGACATGTCTTGTGTCTCTAGAAAAATTGGATTTTTCGGA GATTTTATGTCACATGGTGGTAATTTTAGGCTATTC-3′ by site directed mutagenesis resulting in pFW136. .. The TF sequence from E . coli was amplified by PCR from DH5alpha genomic DNA with primers (5′-GGGGCATATGCAAGTTTCAGTTGAAACCAC-3′) and (5′-CCCCGGATCCTTACGCCTGCTGGTTCATC-3′) and cloned with NdeI and |